Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YH04FM1
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00000025001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE54934.1| Score: 305 E_value: 2e-26
KEGG Definition: sterol O-acyltransferase/Diacylglycerol O-acyltransferase [EC:2.3.1.26]; K00637 sterol O-acyltransferase
Accession: aor:AO090009000480 Score: 305 E_value: 1e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB16YH04FM1
TTGGATTTCCTGAAATTGACCCTCATGTCATGTCCCTTTATTCCTCCTCC
TAATATATGATATTACTATATCAGCTTGAGCGGACGGACGCCCAGCAGAC
CACCGGTATTTGTCTTTCTTGTAGGGTTTGCTATGATTGAGCCCCTTTCC
CCCTATAGGTTCCATTTTCCTTGACACTTGACTTTGGCACCATATCCTGA
ACACACAGCTACTCGAGTACTCTCGCCACCGCCCTCCCGCTTTCCCTGTT
CGTCGCAAGATGGAATCCCAGCCGAAGATATCTGCGTTTTCAGCCTCATC
CTCCGCTGGCATTAACCACGACCCACTAGAGAACATTCTCCGCGCTAGAT
CCAGCAATGGGGGCCGCGCAGAATCTGCAAGAGCTATCAAATGGGGAAGC
TCATTTGAAGCCTGTTCCAGCTCGTTTGGAGAGTGAAACTTCGTCAGTAC
TCTCCAGTGGACGAAGTACTCCAATTCCTGAAGATGCACCTCCGAGTGCT
CACTCAATACAGCATGCCCGCCGGGAGCGCCGGCGGCGAATGTTCCCAAC
CGTGGACTACGAGAGCCGTGTCTCGCATTTCGACCCCCAGTCTCAGCATC
GTGATTTCCGGGGTTTCTTTACGCTGTTTTGGATCGGGCTGTTCATTATG
GTACTTACTACAGCGTTGAGGAATCT

Sequences in the Contig:

SY0AAB16YH04FM1