Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YD08FM1
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00005895001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0116 Score: 109 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB16YD08FM1
TTGGCACCGATCTACAATGGCTCACTAAGAAAGCCTACTGTGATGGGAAA
ATTCAAGACATCAAAGACGGGAAGATCCAACCAACACTACACCCACCCCA
TAAGTCCCCCAGCAACAAGAGTGGACACCGCGGGAACAACCAGCGAGGGA
ACAACCAGCGGGGTAGAGGCAAGGCCGGACGAAGCGGCAACGGTGGGAGG
GGAGGCGGAAGACACCAGGGTAGCAACGGCAGAAGGGGAAACGGCGGGAA
GGGTAGAAATGACCGTGGTGGACCGCCAAAGATCAAGACTACCCCAGGGG
GGGTAGATGGGATTCCGCTGGTGAAAACAAACGGGAGTGCCTCCGAAGCC
GACGAGGATAACAACAACAAACGCAAAGCGGAGAATAGTGCTGAAGTGCA
CACGGAAGTTAAAAAGATCAAGCAGGAGTGTGACAATACCTACATTAAAC
AGGAGTGCGACAATACCCACATTAAACAGGAGTGCGATAATACCCACATT
AAACAGGAGGCCGCTTGAACGAAACGAAACGCCCTTGCGCCCACTTTATG
GCACTTTATGTACTATAGCTAAAAGTTAACTAACGTCCACCCATGATCGG
TATTGGAGACTTGGCGGGAGCAAAGAAACAGAAAAGTAATGACGGAGGGA
TGAATGTTTTTTTCTCTCTTTTTGCCCTGTCTTAGCTTA

Sequences in the Contig:

SY0AAB16YD08FM1