Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YB22FM1
Length(NT) : 603
Best Gene Model Blast : Link to GSTUMT00005409001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001242008.1| Score: 233 E_value: 4e-18
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G12875 Score: 215 E_value: 3e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O94716|FTA4_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0000776 = Cellular component: kinetochore

Sequence:
>SY0AAB16YB22FM1
TTGGGTCGCTAAGAGGCATCAGAAACTTGTCTACAGTTCGCAGGCTTTGA
GGCATGTTGCTGAACAGATCGATGATTTGTATCAGAAAAAAGACGACAAT
GTGGAGGGTATCACACAAGAAGACGATGTCCTAAGGCGGGGAGCGAATCT
TAAAGATCCTCAAAATATCGATCTTCTTCCAGAAAGCTACCCGGCAGAGG
AAAAAGACAGTGAAGAGGATTTGGAAGAATATCAAATCCTAAAGGCAAAG
CTAGCCAATCACTCAGCTGCGCTTCAAGCCCAGCGTCAGAGGCATGCGTA
TTACTCTCAGCTAAAGTCCTTGATAGCTCCTTTTGCAGACCCCCAGCAGT
CGGTGCAGCCAAATCTTGTTACCAAGGATGGTCCGTTAGCAACAGAGTTG
GAGCGAACCCGACTTCTCGCTGCGAAGTTGGCATATCAGATCGAGAAGTC
TAAATTTCCAGACACAGACCGAATGGATGAGGACGAAGATGATGAAATTG
AGGAAAGTGTGGAGGATCAGTTAAGGAAGATACTTGAACAAGCAAACTAA
TTTGTCGGACATTCATCTTCATTAGCACCGCCAGCAACTCTGTCATCACT
AAT

Sequences in the Contig:

SY0AAB16YB22FM1