Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YB13FM1
Length(NT) : 709
Best Gene Model Blast : Link to GSTUMT00002324001 E-value : 1e-108
Numbers of ESTs : 1

Blast Results:

Nr Definition: NADP-dependent mannitol dehydrogenase
Accession: gb|ABB55877.1| Score: 284 E_value: 8e-24
KEGG Definition: alcohol dehydrogenase, zinc-containing, putative [EC:1.1.1.-]; K00100
Accession: afm:AFUA_1G04620 Score: 245 E_value: 1e-19
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0023 Score: 160 E_value: 5e-12
PFAM Definition: ADH_N, Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure..
Pfam Number: pfam08240 Score: 220 E_value: 6e-19

Sequence:
>SY0AAB16YB13FM1
TTGGCTCCCTTACCCGTTTGTGTTTGTCCTCCATTCGTCTATCCAAATCA
ATTAAGTACCGTAAACCTTTTCTGTCAAGTAGTCATCTTCCTCAATCAAT
TCATCCAATGTCTCTTCCAGCAACCATGAAGGCTCTCCGCTACGACAAGC
CAGAGTCGTATGCTGTTGTTGAAGTCCCGTTGCCTACGCGTGATAACGAT
GTTTTGATCAAAGTCAAGGCTTGCGGTGTCTGTGGAACTGTGAGTGATCT
CTGGTGGTGTTGGTGGTGGTAGTGATGAGGAACTGTATACTGATGAGGAT
GGGACGGAATGGTAGGATCTGCATATTCACGAGGGTGAATTCATCGCAAA
GGTAATTTGAAAACCCATACCCCTCTTTCGATAGGAGGAAGTTTCTTTTA
TATACTTACATGGTGGTGGATGGTGGCTGGACACCCTTATGGGCAGTGTC
ATGACACCTTTGTGGACACTTTTTCCGTGATCTTAGGCTAACGTGATGTG
ATCTTCCCCTGCAGTTCCCATTGATTCCTGGACATGAAACTGTTGGTGTT
GTTGCTGCCGTCGGAAAGGACGTCAAGGGATTTGAGGTTGGTGAGCGCGT
ATGCGCTGATAACTCGGAGCTCTGCAACGAGTGCTTTTACTGCCGTCGTG
GACAACTCTTGCTGTGCGAGAAGTTCGAGGCTCATGGTGTCACCATGGAC
GGTGGTTTC

Sequences in the Contig:

SY0AAB16YB13FM1