Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YN13FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00010376001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: FAD_binding_2, FAD binding domain. This family includes members that bind FAD. This family includes the flavoprotein subunits from succinate and fumarate dehydrogenase, aspartate oxidase and the alpha subunit of adenylylsulphate reductase..
Pfam Number: pfam00890 Score: 105 E_value: 8e-06

Sequence:
>SY0AAB15YN13FM1
TTGGCGAACGTCTCCCCCGATATCAGCGCGATAACACCATCCGCAGTTGT
GGAAGCTAAACCATTGCTAAACAATTTATTAAGAGCCTCCGTCTCCCGTA
ACGGGAACTGGTCGGGTGAAACCCTGAAAACCCCGCGCGGTCCGTGTTAA
CTTAGAAGCTCACGATGACGCGTGGAGCGCAGAAACAAGCGGGGGCAAAA
TGGGACCCACCACTCGCCGCGATCAACAACCACAACTTCAAGACCCTCGC
CCGCCAATCGAGCCGCCGCAACAGCTCCCCCACATCCCGACCCGACAATT
ACAACGTCACACTCGAGCACCTTCTTCTCGCTAGTGGAAAAGTCAAGAAA
CTCAAACTTGTAGAAGTCCCCGGGTTCCCCATCCAGAGCTTTCACCCCGG
CTCCGGTCTTCTCCGGATACCCGACGGCCCCGTAGTACATGTCTGTATCC
GCATTGCGTGTCCAGACCATCATTGTTAGTGCCGTGATGGCCTTCGCAAA
CCCGCGAATTGGCGGGAAGAGGAGGCGGGATGACTGGTCGAGCCAAGAGA
CAATAAGGTCCTCACGAAC

Sequences in the Contig:

SY0AAB15YN13FM1