Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YN11FM1
Length(NT) : 669
Best Gene Model Blast : Link to GSTUMT00001866001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543572.1| Score: 256 E_value: 6e-35
KEGG Definition: UBA/TS-N domain protein
Accession: afm:AFUA_5G09630 Score: 245 E_value: 3e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 144 E_value: 3e-10
PFAM Definition: No Hit Found
Swissprot: O13773|UCP7_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0031593 = Molecular function: polyubiquitin binding
GO:0030433 = Biological process: ER-associated protein catabolic process

Sequence:
>SY0AAB15YN11FM1
TTGGCTCCAGACATCCTCTGTCTCTCGCCAAAAGGGCACCGAATCTTTTA
GGCGTGGAGACTACCCCACTGCCTTAGCCCACTACACCTCCGCATTGAAT
CCAATACCCCCCCAGCACCCAATCCGCATAATCATCCTCTCAAATCGCGC
CCTCTGCAACCTCAAAATCGGCGACAGCCGAGCGGTACTAGCAGACTGCG
ACGAAGCACTCGAAATCATTGGACCCAGCAATGGGCGAAAGCGAGACCAT
CACTTTGGAAGACGGGACGAAGAAGGACATGAAAGAGCTGTTTGGAAAGG
CACTCGCCAGGAAAGCCGAGGGGTACGAGCACATGGAGAAGTGGGCCGAA
GCTCTAAAAATCTGGACACAAGCTGTAGAAGCCAGCGCTGGCGGAGCAAT
CGCGATATCTGGAAAACGCCGCTGCTCAACCGCCCTCCAACCCAAACCCG
CGCCGAAGCCAAAGCCTGTTGCCGCTGCTCTGCCCACCGCCCGACGCGCT
CCGCGCTCATCACAGTCCACCGGTAGCGGTAGCGGAGAAGCAGCGCGCGT
AACCGCCCTCCGCCAAGCAAACGCTGCAGCAGACAGAGTTGAAGAGGAAA
AGCTAGCTCTCCACGACAAAGTCGAGGACCGCGTGAACGCCTGGAAATCT
GGCAAGGAGGGTAACTTGC

Sequences in the Contig:

SY0AAB15YN11FM1