Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YM20FM1
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00011866001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05593
Accession: ref|XP_001246152.1| Score: 129 E_value: 5e-06
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G01910 Score: 125 E_value: 8e-06
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2051 Score: 113 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB15YM20FM1
TTGGCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTA
ACGGGGAAAAAAGGTAGACAGCAAGCGATGCAAGAACGCGAAGAGCGAAT
TGAACAATTAAGGGCGAAAGGTGTGATTATTCTAACTGCTGAAGAGAAAG
CCAAAACCGAACAGCAAGCTGTTGATTATATGGAGAAGGCACGCAAAGAA
GCCTTGGCCATTAAGAGGAGAGAGAAGGAGGAAAAGAAAGATGGTATCAA
GAAAGAGGGTGCCACTATAGATGACATGGACCCCAACGAAGACAATGAAG
ATGTTGACTGGCTCGAAGACGAAGATATCGTGGAAATACTATCTGGTTCT
GAGGAAGATGAGGATGAGGATGAGGATGAAGGGGCCGTTAAGCCCAACGA
CTTCTCTGATGAGGATGAGAGCGGACTTGTGGATGGCCCAGGAAGCCCAG
AGTTCCCCTCACTGTGCCCTCAAGATAATGACCTAATGTCACCGACTCCT
CGGTTATCTGAGATGCCAGCTGCCTATGTTGATGAAGAAGCGGGTGAGGA
CTCAGACGAGAGTAATGGCGATTTCGCACCTTTCAAGACCCTCAAGAGAA
GGGCTATA

Sequences in the Contig:

SY0AAB15YM20FM1