Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YL20FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00002095001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: fatty acid synthase subunit alpha
Accession: ref|XP_001547465.1| Score: 848 E_value: 2e-89
KEGG Definition: fatty acid synthase alpha subunit FasA
Accession: afm:AFUA_3G04210 Score: 837 E_value: 2e-88
KOG Definition:
Classification: [Lipid transport and metabolism, Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1394 Score: 137 E_value: 2e-09
PFAM Definition: Ketoacyl-synt_C, Beta-ketoacyl synthase, C-terminal domain. The structure of beta-ketoacyl synthase is similar to that of the thiolase family (Pfam::PF00108) and also chalcone synthase. The active site of beta-ketoacyl synthase is located between the N and C-terminal domains..
Pfam Number: pfam02801 Score: 134 E_value: 4e-09
Swissprot: P15368|FAS2_PENPA
Gene Ontology:
GO:0004316 = Molecular function: 3-oxoacyl-[acyl-carrier-protein] reductase activity
GO:0004315 = Molecular function: 3-oxoacyl-[acyl-carrier-protein] synthase activity
GO:0004321 = Molecular function: fatty-acyl-CoA synthase activity

Sequence:
>SY0AAB15YL20FM1
TTGGCTCAGAAAATCCCAGATCAAGCAATGGACTGAGAGCGAGCTCCTAT
ACCTTCAGGAGGAGGTTGCGGCGATGAAGGCTGAGAAAGTTGACTTTGAC
GAGAACGAGTATATGCAAGACCGTGCCGGCCATATCGAGCGAGAATCGCA
AAGACAGGAACGAGAAGCCCTCAATGCCTGGGGCAACGACTTCTGGAAGC
AGGATCCTCGTATTGCACCATTGAGAGGAGCCTTGGCCGTGTGGGGCTTA
ACCATTGATGACTTGGGCGTTGCTTCTTTCCACGGAACCAGTACGAAGGC
AAATGATAAGAATGAGTCTGATGCGATTAACAAGATGATGATGCATCTTG
GCCGGCATAAGGGTAATGCAGTCCTCGGTATTTTCCAGAAATACCTCACC
GGACATCCCAAGGGTGCCGCCGGCGCTTGGATGATGAACGGAGCCATACA
GGTCTTGAACTCGGGCCTTGTTCCCGGTAACCGAAATGCGGACAACGTCG
ACAAAAGTCTTGAACAATTTGATTACATCGTGTACCCAAGCCGTAGCATC
CAAACCGATGGTGTCAAGGCATTTTCGGTCACTTCGTTTGGTTTCGGTCA
AAAGGGTGCCCAA

Sequences in the Contig:

SY0AAB15YL20FM1