Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YK24FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00002358001 E-value : 2e-40
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein UM03550.1
Accession: ref|XP_759697.1| Score: 112 E_value: 1e-09
KEGG Definition: hypothetical protein [EC:2.7.7.6]; K03011 DNA-directed RNA polymerase II subunit C
Accession: uma:UM03550.1 Score: 112 E_value: 7e-10
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1522 Score: 129 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: P37382|RPB3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005665 = Cellular component: DNA-directed RNA polymerase II, core complex
GO:0005515 = Molecular function: protein binding
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>SY0AAB15YK24FM1
TTGGGACAGTCTTTATCATCGTCACCAAACCACCAACCAAACAACACAAG
CCCTGTTTTTCTTTTTCTTTTTCTACCCTGCATAACTGGATAATCGGCAA
ACATGGATGACTATGATACTATCTACGGTTCTGATCGCGGACGTATGTTG
TCCTGAGTTCTTTCCGCGACGCTAAGGTGGGTTTGTGTTTGTGCTGTCTG
TGGCTAATTTGCTGCGTTCGTACAGCTCAGATTACCATCAAGGAGGCGGA
CAGCAGGCATGCGCAGATAGTGCTTTCTAACTGCGATCTTGCGTGCGTTT
CCTTTTTTTCTTTGTGTTCCTGTTTCTTTTGCTTCCGCCCCTGCTCTATC
CTTTTCCGCCCGCCCGATGCTAACCAACCGACCCGGGATCTCGCAGTTTC
GCAAATGCCCTTCGCCGTATTATGCTCGCAGAGATTCCCACGATTGGTAG
GTTTATGGAACGAGTCGCTACTTATCCGTTCCTTCGTGCACTTGGGGGCT
AATGTTGGTGGGTTTCTCAATGTAGCAATCGACATTGTGGAAATTCAGAC
AAACACCTCCGTCATCCCCGATGAGTTCCTCTGCCATAGGCTTGGAATGG
TCCCGCT

Sequences in the Contig:

SY0AAB15YK24FM1