Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YI13FM1
Length(NT) : 594
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHLREDRAFT_155068
Accession: ref|XP_001698950.1| Score: 153 E_value: 8e-09
KEGG Definition: NEMVEDRAFT_v1g133330; predicted protein
Accession: nve:NEMVE_v1g133330 Score: 137 E_value: 3e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB15YI13FM1
TTGGGGATCTTTCCTTCTGGCTAGCCGCATGCCCTTCACTGGGTGTGTCG
GGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCAT
ATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTTCTAT
TTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGC
ATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAA
CTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAA
GTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTCAACCATAAACT
ATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCT
TACGAGAAATCAAAGTCTTTGGGAGAGGGGGGGAGCGGAAGGAAAGGTTT
ATTCATACTCGAACGAAATTCATGACCTCGATCATCTTGTTGCTTCAGCA
TCTGCGAGAATACGGAAAATGCAATCCACTGACGGAATCGGTGGGAGGCT
CCTTCTGTCTGGCTCACGAGGGTAACATACATACATCGTCACGG

Sequences in the Contig:

SY0AAB15YI13FM1