Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YF17FM1
Length(NT) : 504
Best Gene Model Blast : Link to GSTUMT00006457001 E-value : 2e-76
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 129 E_value: 1e-08
PFAM Definition: DUF1770, Fungal protein of unknown function (DUF1770). The function of this family is unknown. These proteins are rather dissimilar except for a single strongly conserved motif (PDLRFEQ)..
Pfam Number: pfam08589 Score: 123 E_value: 6e-08

Sequence:
>SY0AAB15YF17FM1
TTGGCTTAACTAAACACCGCGACAAACAAACAAACAACATCCCATCAACC
ACAAGATGCCCACCCCTCACCTCCCCCAGCTCCAAGACACCCTGCTCTCG
AGCTCCTTCGACTCCCTCCACTCCCTGGACTCCCCCACCGCCTCGGAATA
CAGTACGTCCCTCCTCCACCACCACCACCGCTACCAAAGGCAGCACCCCC
TACCCCCCATCCCGGATCTCCGCTTCGAGCAGAGCTACCTGAACAGCATC
GCCGCGGCGAACGGCGTGTGGTGGAAGGTACTGCTCATCACGATGAAGGA
CCAAGTGCTCCTGCCGCTGCTGCAGGGTCTCGGGTACAATTTGGTGCTTA
TTGGGTGGAAGGGGTGGAATTTGGGGGCTGGGTGGGGTGGGAGGGGGGTT
GGTTCGAGGCTTCGGGGATGGTGGTGGGGGGTTAATTATTGGGAGGGGAA
GGCATGATAATATGATACTGGTGGGGTATAGCTGGATGGGGGGGGTTTTT
TTTT

Sequences in the Contig:

SY0AAB15YF17FM1