Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YD19FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00011468001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: IQ and HECT domain protein
Accession: gb|EDP55758.1| Score: 405 E_value: 6e-38
KEGG Definition: IQ and HECT domain protein [EC:6.3.2.19]; K10589 ubiquitin-protein ligase E3 C
Accession: afm:AFUA_1G04210 Score: 405 E_value: 3e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB15YD19FM1
TTGGAGAAAATCTAAGCGTATTTCTCAAGAACCTGGCCTTTGCGATGTAT
TACTTGGGAGGGGAGATAATGGGAGAGGACAAGCAGAGGTCCGATGGAGG
AGCTGTCTTTTTCAAAGACCAACCAAATCAGGTGTGGGAGGTTGAGTATT
TGAAAACTGCTGTGACAGGACTCTTGAAGGCCATCTATGCTAGAGATTCG
AGACGAAAATTCCTCCCATCCAACCACTGGCTTATGACCGCCGCTGGCTT
CAACATCGAGGGCTTTATTCCTGCCGTCGTGCAGGAAGAGGAAAATAGAC
ATAAGATGGAGAGTGAGGGGGAAGATGACGAAGAACCGGAACGTCAATAT
GATCAAGCAGCAGTTGCGGCGCTAAGTCCGCACGAGCAACGAAATCTGCA
ATTGGAATCGAGGGACAGGACACAGCGCAAAAGGCAGCGAGCTCTCTACT
TAGCAGCCATCACCCCGCGCCTTGAGATACTTCAAAATCTTCCCTTCTTT
ATTCCCTTTGCTACTAGGGTGCAAGTATTCCGGGAATTTGTCTCAGGTGA
CCAACGTCGGCGCCGCGGGGGATTTGTTGACCCGGATCAATGGAGGGCTG
CCATGCTCTCGCAGAACTCTCGGCCACCCTCCCTAATACACGATGCACTT
GG

Sequences in the Contig:

SY0AAB15YD19FM1