Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB15YB24FM1
Length(NT) : 553
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-155
Numbers of ESTs : 1

Blast Results:

Nr Definition: heat shock protein sspB-Aspergillus niger emb|CAK40452.1| heat shock protein sspB-Aspergillus niger
Accession: ref|XP_001393974.1| Score: 374 E_value: 2e-34
KEGG Definition: sspB; heat shock protein sspB-Aspergillus niger
Accession: ang:An09g06590 Score: 374 E_value: 8e-35
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0020 Score: 459 E_value: 7e-47
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 499 E_value: 2e-51
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAB15YB24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCATAAGGTTGAGGTTGTTACCAAGTCGAACGAAGATGAACAAT
ACATCTGGGAGTCGGCTGCTGGTGGTTCTTTTACTATCAAATTGGATGAG
ACCGGAGAAAGAATCAAGCGTGGTACCAAGATTGTCCTTCATATCAAGGA
TGGTCTGCAAGAGTATCTCGAGGAGTCTAAGATTAAGGAGATCGTGAAGA
AGCACTCCGAGTTCATTTCATACCCTATTTTCCTCCACGTCACCAAAGAG
GTTGAGAGAGAAGTTCCTGACGAGGATGAGGAGGAAGAGAAGACAGAAGA
GGGTGATGATAAGAAGCCCAAGATTGAAGAGGTCGATGAAGAAGAGGAAA
AGAAGGAGAAGAAGACCAAGAAGGTGAAGGAGACCAAGGAAGAGGAAGAG
GAGCTGAACAAGACAAAGCCCATCTGGACTCGTAACCCCTCCGACATCAC
TACTGAGGAGTATGCCAGCTTCTACAAGTCTCTATCCAACGACTGGGAAG
ATC

Sequences in the Contig:

SY0AAB15YB24FM1