Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YP22FM1
Length(NT) : 513
Best Gene Model Blast : Link to GSTUMT00002000001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU05253
Accession: ref|XP_961790.1| Score: 138 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: ncr:NCU05253.1 Score: 138 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB14YP22FM1
TTGGGTGAAAACGACTGGGGGGTTGTTATGTTCAAAGACCTTGAGGTCAA
TTTCTCCACCGGGCAGATCTCCACTGTGCTATTCCGTCCGGAGGATATTG
CCAAGGGGTTTGACCTGGAATTGGCGTTTCTGGGATACCTGTCCCTGTGC
AATCCGCAAGCTACTTTTTCAACGCTCCGGGAATGGTGCGCGCGTATCAC
CGAGCGGAGCAGGAGCGGCGCTATCGTGGAAGAAATGGGTAGGAAGTGGC
GGGAGTTCGCGGCCGGGTACGCGCTGCCCGAGGGCGATGGCGGGAGACTC
ATCGACCCGAGGATCGGAGAGCTACTATCCCTACGCGGGGCCGTGGGGAG
AAAAAGGGAAATGTTCCTGCCAACACTCTGGGAAGACACGAGCCGCGCAA
GCGCCTGGGACGTTGGTCGCGAAGTGCGAGCATTGGCCTACTCCCTCCTC
TTCCCGGGTGAAATGTCTCTGGAAGAAATCTCTAGAAGGGGTCACGGGAT
TTCTGGAGCGCCC

Sequences in the Contig:

SY0AAB14YP22FM1