Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YP09FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00004960001 E-value : 1e-163
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquinol-cytochrome c reductase complex 14 kDa protein
Accession: ref|XP_001267347.1| Score: 310 E_value: 5e-27
KEGG Definition: hypothetical protein
Accession: ang:An04g01200 Score: 298 E_value: 7e-26
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3440 Score: 250 E_value: 2e-22
PFAM Definition: UCR_14kD, Ubiquinol-cytochrome C reductase complex 14kD subunit. The ubiquinol-cytochrome C reductase complex (cytochrome bc1 complex) is a respiratory multienzyme complex. This Pfam family represents the 14kD (or VI) subunit of the complex which is not directly involved in electron transfer, but has a role in assembly of the complex..
Pfam Number: pfam02271 Score: 259 E_value: 1e-23
Swissprot: Q871K1|QCR7_NEUCR

Sequence:
>SY0AAB14YP09FM1
TTGGCACCCTGACTCTTTTTTCTTCCTCGCCTATCATACCAGTGCAAATG
AGTTTCACCTCTGGTCTTGCTCTTCGCCGTGCAATTGTTGCCAGACCATG
GCTGCACAAGATGATGGCTCCTATCGCTGAAAAATACAACGACCTTGCTG
GATACCGTAAGCTTGGCCTCGTCCGGGATGACTTGATCGCCGAGGAAAAC
GAAATAGTCCAAGAGGCGCTCAAGCGTCTCCCCCCTAAGGTTGCTTACGA
CCGCGTGTACCGTCTACGAAGGGCGATCCAATGCTCGCTCGCGCATACCA
TCTTGCCAAAAGAGGAACATACCAAGCCCGAGGGGGTGCGTTATATCCGC
CTTTCACACATAAACGGAGGTTGAATGTCACGTCTTGGAGGCTAATCTAC
TCTTAGGATATATCTTACCTGATGCCCTATATTGAGGAGATTGAGAGGGA
GAGGAAGGAGAAGGAGGAATTAGATTCTTTGACTCGTATTAGATAGGTTC
GGATGAGGGGTTGGAAAAATAGTGCTATATCAGGATTACGGGCCGATGGG
TGGGCCGATTGATGGATGTACACACACATGGGAGCGGGGGTGATTCAGCG
GGCAAATGTTTAT

Sequences in the Contig:

SY0AAB14YP09FM1