Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YO10FM1
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00007223001 E-value : 1e-122
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 381 E_value: 4e-35
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 359 E_value: 7e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 254 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: Q8UVC3|INVS_CHICK

Sequence:
>SY0AAB14YO10FM1
TTGGGCCTGCTACATCATCGAGGAGTCTCCACACAAAGCCCCGCTTTTCT
TCATTCGCCAGAATTCCAGCCACTGGCTAACTACATCATCTATCTCCTAC
GAAATACCCCAAGCAGCGGATAAGGGAAAATGTCTCAACCTTTCGACAAT
AATTTCAACTATTATAACGGGCCCCACCGAACACCACTCTGGTATGCTGC
TAATAATGGGCACGAGGAAGTGGTGAAGATGCTACTCGGACGGCAAGATA
TCAACCCCGATAAAGCGGATGAAGGCGATCAAACACCACTCTTTTGTGCT
TCGGAGCATGGGTACGAAGAAGTGGTGAGCATGCTACTCAGACGGGACGA
CGTCAACCCCAACAGACTGGATGGCGAAGGCCAAACACCACTTCATCGTG
CTGCTTGGGGTGGGCGTGAGGGCGTGGCGAAAATACTACTCGGACGGGGC
GATGTCAACCCCAACGTACCTGATTACTACGGCAATACACCGCTTCATTG
TGCTACTTGGAGTGGGCACGGGGGAGTGGTACAGGCCCTGCTCGGACGAA
ACGACATCAGTCCCGACAAACCAAATAACGATAGCCAAACACCACTCTGG
TATGCCGCTCGGGATGGGCACGAGGGAGTGCTAGAAGCACTGCTCGGACG
GGGCGATGTCAACCCCAACGCAACAGATGACGATGG

Sequences in the Contig:

SY0AAB14YO10FM1