Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YH14FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00006929001 E-value : 1e-177
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_02966
Accession: ref|XP_001596743.1| Score: 292 E_value: 7e-25
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04416 Score: 284 E_value: 3e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P46547|PIP_AERSO
Gene Ontology:
GO:0016804 = Molecular function: prolyl aminopeptidase activity

Sequence:
>SY0AAB14YH14FM1
TTGGGTCTGCTTTACGCACAAAGCCAAATGACCCGGAATTCAATTTGGCA
CAAAGCCTCGAAAGGAAAGGTCAGCCAGCATATTTCACCGGCGAGATGGT
CACCCCCCTTCTTCCTTCTCCACTCACAAGTACTCACATCAATAGATCTT
CCCCTGGACCTTCGAAGACCACGCCGAGCTCTCAAAGCTCCACTACGTAG
CCAAAACACTCGCCGAATATACAGAATGGCCATCCCTCTACTGCGAGGAT
GTGCTTGCGGAGAACAGGGTCCCGGTTTATGCAGCGACGTACATAGATGA
TATGTACGTTGACTGCACACACGCGCGCAGGACTGCGGGAAAGATTCGCG
GTGCAAAGGAATTTGTCACAAACGCTTTGATGCATAACGCGATTAGGGCG
AGGACTGAAACAGTTATGGGGGAGTTGTGGAGGCTGAGGTCTGGAGAGGT
TGATTAGACTATATAGAGGGTGGGTAGGGTGGCGGAGGCTTAATCGTCGG
GGGCGGGTTTTTTTTTGTGGGGACGGTTAAAAACTTACATGAATGATGGA
GGCTGTTTGCTTGCTATAAGTTGCTATGGTGCCAGAACCCGTGGATGGTA
AGTGTGTAACTCCCGC

Sequences in the Contig:

SY0AAB14YH14FM1