Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YE14FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00003750001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1198.2
Accession: ref|XP_658802.1| Score: 463 E_value: 7e-45
KEGG Definition: hypothetical protein [EC:2.1.2.10]; K00605 aminomethyltransferase
Accession: ani:AN1198.2 Score: 463 E_value: 4e-45
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2770 Score: 481 E_value: 2e-49
PFAM Definition: GCV_T, Aminomethyltransferase folate-binding domain. This is a family of glycine cleavage T-proteins, part of the glycine cleavage multienzyme complex (GCV) found in bacteria and the mitochondria of eukaryotes. GCV catalyses the catabolism of glycine in eukaryotes. The T-protein is an aminomethyl transferase..
Pfam Number: pfam01571 Score: 264 E_value: 3e-24
Swissprot: P48015|GCST_YEAST
Gene Ontology:
GO:0005960 = Cellular component: glycine cleavage complex
GO:0005739 = Cellular component: mitochondrion
GO:0006546 = Biological process: glycine catabolic process
GO:0006730 = Biological process: one-carbon compound metabolic process

Sequence:
>SY0AAB14YE14FM1
TTGGCGCTTCGAATTGCTGTCAATTCGAAGTTCAATGCATTCTCAAGGTT
TTACAGTGATGCTGCTCCTGGAACTCTTGCGAAGACTCCCCTCCACGACC
TCCATGTTGCGAAGGGAGCGAAGATGGTTCCCTTCGCGGGGTACTCTATG
CCCGTGCTTTACTCCGGAGAGAGTGTGGGAGAGAGTCATAATTGGGTCAG
GGAGAAGGCCGGGCTGTTTGATGTTTCCCATATGGTTCAGCACCGTTTAA
CCGGTCCCGGAGCATTGCCTTTCTTACACTTCGTTACCCCCTCGGATCTC
ACACGCCTGCCGCAGTTTCAGTCTACGCTTTCGGTGTTTTTGCATCCGAC
TACTGGTGGGATAGTGGATGATTTGATCATCACCTCGCATGGGCCCGAGG
ATTTCTACATCGTTACTAATGCTGCGTGCAAAGATAAAGATCTTGCATAT
ATGGCTAGGAATATGAGGCACTTGTCTTCTTCGGACATTAAACATGAAGT
TCTCATTGGACAAGGCTTGGTTGCCTTGCAAGGGCCTTTGGC

Sequences in the Contig:

SY0AAB14YE14FM1