Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YB02FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00006527001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12462
Accession: ref|XP_001586476.1| Score: 499 E_value: 7e-49
KEGG Definition: hypothetical protein
Accession: ang:An17g00880 Score: 449 E_value: 2e-43
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3870 Score: 400 E_value: 6e-40
PFAM Definition: DUF89, Protein of unknown function DUF89. This family has no known function..
Pfam Number: pfam01937 Score: 307 E_value: 3e-29
Swissprot: O94725|YCFD_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB14YB02FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCAATTGGATGCCCTTTTCA
CGTAGCAACTGTCTAGCAAACTCGAACTCGAATTTCGGGTAAGCCTTATT
AACTCCATCATTTATCCTCCCATTGAGTCGCGATTATGGATCCCGGCCTC
CCTAAAGAACCATATAGGATCTCGGATAAGAACTCTTTTGCTTATGTTTC
TGCACGCGACCGATGGCCCGTGATATTGACCCAAGCAGTCGATGATGTCT
TTAAGCACGGAGATTCTGAAGATAGTAACCATAGACATGAGGGAAGTAAG
ATTATCAGGCAGATCGCACAACTTAAGTTTGAGTTACAGCACGATCGACT
CATAAGACCCTTGGAAGATGACGGGGGAGATGATATCAAGGGTTATAATG
AAGAGCTAGAGAAGTTGGGCAATCCCAAGTGGTTCGATGCGCCGTGGCTA
TTTGCAGAATGTTACCTGTACCGCCGGTTGAATACTTTTTTTACCAACAG
CAAAACTTGGAAAACTCACGATGTGTTCCATGTCCAGAAGGCTACTGCTT
TCAGATCTTCCCGGGCAGCAGTTCTCGAGTTGGCTTCACGATATCGGCAG
CTAGTCTCTTCTC

Sequences in the Contig:

SY0AAB14YB02FM1