Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YA23FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00007470001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: integral plasma membrane protein, putative
Accession: ref|XP_001263486.1| Score: 614 E_value: 3e-62
KEGG Definition: FGF receptor activating protein 1
Accession: aor:AO090005001276 Score: 606 E_value: 1e-61
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3979 Score: 110 E_value: 2e-06
PFAM Definition: No Hit Found
Swissprot: P25618|CWH43_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005934 = Cellular component: cellular bud tip
GO:0005887 = Cellular component: integral to plasma membrane
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006506 = Biological process: GPI anchor biosynthetic process
GO:0007165 = Biological process: signal transduction

Sequence:
>SY0AAB14YA23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTACACCTCTCAGACCTCTA
TTTAGCCCCCTCTATTCCCCTCCCTCGTCACCACCATCACCGTTACCACC
ACTTCCTCATTGCTCTGCCGTTTTCTGTCATTCCTTGATTCTGCTTTTGC
TTGCGCTCTAGTCATGCCAAAAGATAAGGATGGGACCGTTTTGGTCTCGA
TGTCCGGGAAGTGGGTTTCCCACACTCACACAGTAACTGCCTATTGCGGA
TTCCTAGGCGCGTTGATCGTGGGAATGTCACTCCACTTTCACAAAATTGT
TCAGAATGAGCATTATGGTTATCCCGACGAATGGTTTCCATCAGTGTCAG
CTACAATTGGCGACAGATATCCTGAACGATCGCTGTTTCAGCTCTTCATC
TGCTTAACATCTGGTCCTCGTTTCGCCCTCGTTTTCCTGTGGTACCTTCT
TACGGCACGCCCCGGCGCTTTCGCTCCAAAGTTTGTGGCCAGCATTGGTC
TTATCCGTTCGTTACTTTGTGGAGGCTGGGTATACATTACCTCCACCGAT
GACCATGACTATCACGATATCTTTATGATTTCTTAC

Sequences in the Contig:

SY0AAB14YA23FM1