Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YA05FM1
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00011225001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN4037.2
Accession: ref|XP_661641.1| Score: 305 E_value: 3e-26
KEGG Definition: hypothetical protein
Accession: ani:AN4037.2 Score: 305 E_value: 1e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB14YA05FM1
TTGGGCGGCCGCCAGCACCTCCTAACGGGCAGAGGCGGAGTCTTGTCACA
TCCTGGGCACGTCCCTTGAGGACGCCGCAGTATGCCTACGACCACGATGA
TATGTATCTTGCCATGGAAGATGGTGACATCTACTTTTTAGAGGTGGATA
CCCAGGGTCCAAATTTGATTCAATTGGCCAATAAAGCCTGCCGTCTTGAT
TGCTCGATTGGCACAGCGTTTGCATCCTTAGATTTCGGTCTTAACAAAAA
TGACATGCTTGTTGCTGGTGGGGAAATGAGCAGTGGTGGAGTGTACCTTT
TAAAGATAGGGCCACATCCGGCTGAGACTGAACCAAAATTAGAGGAGTCT
GTGGCCAATTGGTCACCGGTTTTCGATTTTGAGCTTGTTAACCTGCCTGC
CCAAGGTCATGCCAGTGGAAAGGTGGAAAGAGATCGGATTCTTGCTTGCA
CGGGTCGTGGGGATCATGGAGCAATTACCGAACTTCGTTATGGAATACAG
GCGAGGATTCAGGGATCAGCGGATCATCAGATGAGAGGTGTTCGAAGGTT
GTGGGTACTGCCAGATTGTTCGGATGTCGGTTACTTCCTGTTCTCGTCGC
TACCAGATCAGTCAAATTTATGTTTCTTGAAACCAGATGGAGAATGGGAG
GACGCAAGTGATCTTGAATTGTTGGATA

Sequences in the Contig:

SY0AAB14YA05FM1