Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB14YA03FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00003180001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001542722.1| Score: 577 E_value: 6e-58
KEGG Definition: hypothetical protein
Accession: ani:AN7783.2 Score: 552 E_value: 2e-55
KOG Definition: No Hit Found
PFAM Definition: CNH, CNH domain. Domain found in NIK1-like kinase, mouse citron and yeast ROM1, ROM2. Unpublished observations..
Pfam Number: pfam00780 Score: 115 E_value: 6e-07
Swissprot: Q9Y7U5|RGF3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0005089 = Molecular function: Rho guanyl-nucleotide exchange factor activity
GO:0006075 = Biological process: 1,3-beta-glucan biosynthetic process
GO:0048228 = Biological process: actin cortical patch distribution
GO:0030994 = Biological process: primary cell septum disassembly
GO:0035023 = Biological process: regulation of Rho protein signal transduction

Sequence:
>SY0AAB14YA03FM1
TTGGGCATCTTGGAAACCGTTCCTTCAAGGCGGACGACAATACCTATATC
TTATATGCTCCAACTCAGCAGAATCGTATGGACTGGTGCGAGAAGATCAT
TCAGGCTAAGGAACGCCATGCGCAGAGCCTTCATGCGCAGAATGCTGAGC
CTTTCCGATTGAAGGTTATGGCGGATACTGCCTTTGGGTACGAAACCACT
GCTCAATCGGGACCTAAACCGATTATTGTCCGGGGTACCCCTCTTGATCG
TGCCATCGGGGAGGTTGAGAAGATGTACGAGAAGGCGCCAGGACCAAGGC
CAGGCGTTATCTGCAGAGCGAGTGTCAATTGTGCGACTGCTTTTACGGTC
AATTATGGTAGAGAAATGGTGGCCATTGGAACGGATTATGGTGTTTTCAC
GGCAGATGCGAAGAACCCTCGAGGTTGGCAACGGTCTATCAACCTCCCCA
AAGTGACTCAAATCGCCGTCCTCGAAGACTTCAGTCTCTTCCTCGTCCTC
TCGGACAAATCCCTAATAGCCTACCACTTGGATGTAGTAATTCCCCCACC
TGGCGCCTCTCCAGATGCCGCCGTCAAGCAGCGCCCGCCGCAGAAACTCT
CGGGCGGAAAAGACGT

Sequences in the Contig:

SY0AAB14YA03FM1