Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YM08FM1
Length(NT) : 675
Best Gene Model Blast : Link to GSTUMT00004861001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09777
Accession: ref|XP_001551507.1| Score: 355 E_value: 4e-32
KEGG Definition: hypothetical protein
Accession: ang:An11g01950 Score: 326 E_value: 5e-29
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1926 Score: 160 E_value: 4e-12
PFAM Definition: No Hit Found
Swissprot: O60094|DPO5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0000182 = Molecular function: rDNA binding
GO:0042790 = Biological process: transcription of nuclear rRNA large RNA polymerase I transcript

Sequence:
>SY0AAB13YM08FM1
TTGGGGCGATGCGAAGCAGTGGGCTGCAAAGGTTACCTATGATGCTTTGG
CGGAGTCTGAGCTGGCGAAGACGAGTGACGGAACAGCTGTATGGTTGACT
CTCCAGGCGTACTGCCCGAACATCCTCCCACCGAAGAATCTCTGGGTGAA
GGAGTGCCCGCTGGCGAAACCGAATTTGGTCACATTAGCAAAGGTCCTGA
AAGAGGCTGGGTCCAAGGATGAAGAGGGAAGGAATCTACAACAGAAGGGC
TCTTGGAACCCTAAACTTAATTTCGTTTGGGATTTAGTGCTTGAAGCGTA
TATTGGCGAGAGTAAAGAGTGGGTGGGTTTTCGAGAACGAGAAACCTCTG
TAATGCCTATGTGGGAGGAGTTCTGGAAAGTTGCTGTAGATGAAAGCCTA
TTCTCCGCCTCCTCTTCCAACCACCGAAAGTTCTGGGGGTTCCTCATATT
CGGGAAGGCACTTAATCGGATTTTTGCCTTCAGTGATGGTGGATCATATC
TCGCGCCAATGTTCTCCAAGAACTTTATGCGATGTTTGATAAATCAGCTA
TCGGATCCAGAACGATACTTGCATAAGGCTGCACAGAAGTGTATTAGAAC
ACTGCTACAAAAGGCTGAATCAACGCCGTGGACGGCTCCCGTGATCTTTG
TGCAGTTGGTCTCAAACAACGGCAC

Sequences in the Contig:

SY0AAB13YM08FM1