Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YL24FM1
Length(NT) : 205
Best Gene Model Blast : Link to GSTUMT00001263001 E-value : 8e-68
Numbers of ESTs : 1

Blast Results:

Nr Definition: prefoldin subunit 4
Accession: ref|XP_001548837.1| Score: 185 E_value: 9e-13
KEGG Definition: hypothetical protein; K09550 prefoldin subunit 4
Accession: mgr:MGG_06730 Score: 177 E_value: 3e-12
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1760 Score: 172 E_value: 5e-14
PFAM Definition: Prefoldin_2, Prefoldin subunit. This family includes prefoldin subunits that are not detected by pfam02996..
Pfam Number: pfam01920 Score: 123 E_value: 3e-08
Swissprot: P53900|PFD4_YEAST
Gene Ontology:
GO:0016272 = Cellular component: prefoldin complex
GO:0015631 = Molecular function: tubulin binding
GO:0007021 = Biological process: tubulin folding

Sequence:
>SY0AAB13YL24FM1
TTGGACCGATGTAGCGGTAACCCGGGAAGACCAAGACCGTATTAACAAGT
TCTCAACGCTACACCAGAAGCAGGGACTTTTGAAAGACGAGCTTGAGAAG
AAGAGCCAAGAAAAGGAGTACATTGAAGACGTCTCTAACGAACTAGAACT
TGCGGATGATGATGACTTGATACCGTTTTCTCACCCCCCCCCCGCTATTT
TACGA

Sequences in the Contig:

SY0AAB13YL24FM1