Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YL13FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00010625001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1296.2
Accession: ref|XP_658900.1| Score: 716 E_value: 5e-74
KEGG Definition: hypothetical protein
Accession: ani:AN1296.2 Score: 716 E_value: 3e-74
KOG Definition: No Hit Found
PFAM Definition: tRNA_lig_trans, Fungal tRNA ligase adenylyltransferase. This domain is found in fungal tRNA ligases and has adenylyltransferase activity. tRNA ligases are enzymes required for the splicing of precursor tRNA molecules containing introns..
Pfam Number: pfam08304 Score: 750 E_value: 2e-80
Swissprot: Q10313|YD61_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB13YL13FM1
TTGGTGGGCTTGATCCGGACAAGTCTCACGCCGTTTTTGGGGAGAAGTGG
GTGGATCGGCAGCTGGAGAAGCTCGGAAAGTCTAGAGCCGAGTTTGCTAG
GGCCTTAAGGGAGGCGAACGTTACTGCTGTGGCCGAGCTTTGCGATGACA
CCTTCGAGGAACATATTCTCCCATACGAAGATGACCGGGCAGGGTTATAT
CTTCACGGTGTGAATCTTAGACTTCCAAAGTTCGCAACTTACTCTGCGGC
AGATGTGAAAAGGTTTGCACGAGATTGGGGTTTCAAGGTGGTAGACTCGC
TTGATAAGCCAGATGTCCAGAGCCTTCGGGACTTTCTCGAGGAGACCGCC
GAGACTGGGTCGTGGGATGGCAAGGACGTTGAGGGTTTTGTTATCCGGTG
TAAGGCCCGCGATGGGCCCGATGGGGAATGGCACGATTGGTTCTTTAAAT
ACAAGTTTGAGGAACCATATCTTATGTACCGTCTCTGGCGCGAATGCACC
AAGTCAATGATCGGTGGCGAGAAACCTAAAATTAAAAAACACAAGGCTAT
AACCACCGAATACCTAAAGTTTGCTGAAAAGTATTTCAGGGAGCACCCCG
AAGCAAAAGAGAAATACGAAGAAAATCACGGTATTATCAAACTGAGGAAT
GCCTTTTTGGAACAC

Sequences in the Contig:

SY0AAB13YL13FM1