Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YK01FM1
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00001848001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 282 E_value: 9e-24
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 282 E_value: 4e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 185 E_value: 4e-15
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB13YK01FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCGGACTATCACCCCCAAC
AAACCTGATAAAACGTTTCGCCGAACAGCGCTCTTATGGGCTGCGTGGAG
GGGACAAGAAGGAGTGGTGAGGACACTTCTTGGCAGGGCATCTGCCAAAC
ATGATGGGACAGATGGTTGGTGGACTGGGGTGCCCCGCGTGATGAACGTA
GTCATGTGGAGGAGGTATGTCGACGCCAGTAGGTCAGACAAATACGGCCA
AACGCCACTGTCATTGGCTTCTGAAGAGGGGCACTCAGGGGTGGTGAAGC
TATTGCTGGGAGGAAAGGATGTCAAACCCGATGCGCCCGATGGATATGGC
CGGACACCTCTCTTACTCGCTTCCAGCAAAGGGCAGGAGGCAGTAGTGAA
GCTACTAGTGGAACTGGAAGACGTCGACATTAATAAGTTAGGTCAAACCG
GCGAAACACCGCTCTCGTTAGCTGCCATGAATGGGCATGATGAAGTAGTG
AGGCTGCTATTGGGACGGAAAGATATCAACCCCGATTTACTAAACAATGA
TGGACGGGGACCGCTCTCGTGGGCTACCGGGAATGGGCGTAAT

Sequences in the Contig:

SY0AAB13YK01FM1