Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YJ06FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00002150001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Mitochondria fission 1 protein gb|AAQ17209.1| putative mitochondrial fission protein Tbfis1p
Accession: sp|Q6WRS2|FIS1_TUBBO Score: 527 E_value: 3e-52
KEGG Definition: hypothetical protein
Accession: ani:AN6225.2 Score: 395 E_value: 6e-42
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG3364 Score: 344 E_value: 2e-33
PFAM Definition: No Hit Found
Swissprot: Q6WRS2|FIS1_TUBBO
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane

Sequence:
>SY0AAB13YJ06FM1
TTGGATTTCCCCCCAACAACCTATCTCACTGTCCACCATACATAGACCCG
TTTCACATTCGGGTTTTTTTTTTCCGAGCCAAGTTTTTCAATTAGAACTC
GATGCCGTCTGATAACCTGCCACGGGTTAGACGCTGTCGATGCAGAAAGC
CCTCTCAAGGAAGCAGAGCTCCAGGTTCTTCGTAACCAGTTCGAAAAGAG
GGACAGTTTGTTGGCGTCCAGACTAAGTTCAACTACGCATGGGGTTTGAT
CAAGAGCGAGAAGCGGTTGGAGCAGCAGATGGGGGTTAGGTTATTGACTG
ATATCTTCCGCGACCATAACGAGCGCCGCCGTGAATGCCTTTACTACCTT
GCTCTCGGAAACTATAAACTTGGGAATTACGCCGAGGCTAGGAGGTACAA
TGACAGATTGCTAGAGAACGAACCGGCGAATTTGCAGTCGCAGAGTTTGA
GGGGGTTGATTGATGATAAGGTTGCTAAGGAGGGTATGCTCGGCGTAGCC
ATCGTCGGCGGTGTAGCGTTAGCAGCAGGACTTGTCGGCTCCGCGCTCTG
GAGAGGTATGTCTAGAAAG

Sequences in the Contig:

SY0AAB13YJ06FM1