Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YG06FM1
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00011418001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06623
Accession: ref|XP_001592382.1| Score: 315 E_value: 2e-27
KEGG Definition: hypothetical protein
Accession: fgr:FG01294.1 Score: 314 E_value: 1e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB13YG06FM1
TTGGCTGCACTGCCGACCTCGCTAACCCCCACACTGTCTCGTCAATCTTC
ACGGGCTCGTCACTCGTCCTATTGCGGGAAGCACGAATCCCGACCAGAAT
TCTTACAACGACAATGGCCGCTTCGCCAACTAGTCTTGAAGAGTGGAGGA
ACAGACTTTTTCACGTAACGGAGGTGATGACACTGACCGAGCAGGAATGG
ATCACATATTGGCCTTACGTTGACAATATCTGGTCTCACCGATCCACGCA
AAAGTCCAAGAAAGGGCCTTTTCAAACGCATTACTATGATTGCCGTCTCA
AAGGGAGACCTCCCGGGACACCGCAAAATCAAGATCCAAATAAAAAGAAG
CGGAAGCGGGCCGCAAGGGAACGGGATCTATGCGATATGAAGATAAAGGT
AGTAGAGACGATAGTGGAGGATGGAAGCGGTGTAGGGAAGACATTTACTA
TTGAAAGAGTGAGAAAGGAAGGGCTCCCACAGAGAGCGAGGATCGGGGAT
CCAGCAGATGTCGGAGAGGGCTCCACGGCAGATGGACAGGTTCTTGAGCA
ACAGTTGGAAGATGTTATGGGTTTAGGGATTGGAGATGAACTACAGCTGA
ATGACTCGGGAGCAGGGGATGGTCCGCACTCCCTGGGCATACTAGCATCC
AATAAGGCTGTGGATATGGACCAATATGGAATCC

Sequences in the Contig:

SY0AAB13YG06FM1