Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YF06FM1
Length(NT) : 585
Best Gene Model Blast : Link to GSTUMT00010930001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_03562
Accession: ref|XP_001557980.1| Score: 482 E_value: 3e-52
KEGG Definition: hypothetical protein
Accession: ang:An14g01630 Score: 517 E_value: 2e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P46950|SNG1_YEAST
Gene Ontology:
GO:0042493 = Biological process: response to drug

Sequence:
>SY0AAB13YF06FM1
TTGGCTTGGTCATCTTCTCCTTCTTCTCCTTCTCCTTCTACCTACCCATT
CACCAAGCTTTCATAATCCCCAGAGACGGTAATTCTCACGCCCACATCTT
CACGAACGATCACTCACCACATAATAAGACATCCCCCCCCTGTCCCTCCC
CCAATGGCTCGTCTGGCGCCTTACGGCAACGTTAACAACCTACTTTTTCC
TCTCCCTCGCCTACTCCCTCGTTCCCCTCTCCTTCCAGATCCCCTTCTCC
CGCTCCTCTCTCCCGCAAACCACCCCGGGCGGAGCAAGCAACTATAACTT
CCCAATCTATTGGATGCTAAACTGGGTCGGGATGTCGGCGCTCGGCCTCG
CTTCCGAGAACATGTCCATGGTCCTGGGCCCGCCGTGGTTTGCCCTGTGG
CTGATATTCTGGGCCATCACGAACGTCGCGACGTCCTTCTACCCGCTCGT
CCTCGCACCCGGGATTTACAGATTCGGGTATGCGTGGCCGTTGCATAACA
TTGTGGCGGCCAGTCGGAGTATTGTATTTGATGTTAGGAATGAGATTGGA
AGGAACTTTGGAGTGCTGTTCGCTTGGGTTTGTGT

Sequences in the Contig:

SY0AAB13YF06FM1