Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YE23FM1
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00009159001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 163 E_value: 7e-10
KEGG Definition: predicted protein
Accession: aor:AO090012000358 Score: 147 E_value: 3e-08
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 107 E_value: 7e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB13YE23FM1
TTGGAAACGACCCACTAGTAATGGATCCTGTGGGCACCTCCGTGTATGAT
AGGGGGCTGGCGGTCCGTAATCATATCCAGAAATATGCCCTTCTCGATTA
CGCAGCTACCCATTGGGCAGACCACTTCCGAGATTCACAAAATCGGCAGA
TGGAGCTATTCGAGCTTACGCAACAGATTTGCAAACGTGGATCCAACATA
TTTCTGACATGGCTTGGGGTGTATTGGGAGAAAAATGGCCAGTATTCCAC
ATTCCCCAATGATTTTACAAATTTGATGATAGCGTCGTGGCTTGGGCAGC
GGACAGTAGTTAAGCGACTGCTGAAAGAAAAGGGAGATATCAATGCTAGG
TCTAAAGGATATGGCACCGCGTTGAACGTAGCGGCTCAGCGGAGAGATAG
GGATATATCTAAGATGCTAATGAAGAGGAGAGTCAATGCCTATATAGGCA
GGAAGGAATATAACATCTTGCTGACGGTATGCAATTTTGCTGTCACCCGA
TGGAGCTGAAGCTAATAGGGGGCATCTCTTGCGTTGCAGAAGAGGGGTGA
GCTTGACGAGGAGTTGGAGCGGCTACGGTGGTGGTGGCGGTGGCGGCTCG
AGGAGGAGGAGCGGGAGCGGGACGAGCATTTAAGTAAACATGATTGGTCT
GGGCTCTGTGACATGCCCCTTGCTGATG

Sequences in the Contig:

SY0AAB13YE23FM1