Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YE08FM1
Length(NT) : 572
Best Gene Model Blast : Link to GSTUMT00001852001 E-value : 1e-110
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 166 E_value: 2e-10
KEGG Definition: ankyrin repeat
Accession: aor:AO090003001310 Score: 158 E_value: 1e-09
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 127 E_value: 2e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAB13YE08FM1
TTGGACAAGATACAAACGGCCGAACGCCCCTCATTGGGGCTGCTCGGAAC
GGGCACGAGGGAGTGGTGAAAATACTGCTTGGGCGGGACGACACCAACCC
CAACAAACCAGATACGGACGGCCGGCCACCACTCTGCTGGGCTGCTGGGT
CCGGCCATGCGGGAGTTATAGCGCTACTACAGTCCCCAGCATCTGGTCAC
CCGTAGCGCGGAATAAGGCCGAGGAGATACCCCCTTCCTTACCTCCTCCG
AGTACGAATAACCTGTGCACCATGTCTGCAAAGACCGCAACAACTCCATA
AACTTTTCTATTACCACTGTTGTCTCCCCTCATCCCCGCACAGTTTCTCC
CGTAGTTTAAACGCCACGTTCAATTAATCGTCCCCTTTTCTCCCCTTCCG
GAGTAAGCCTGCGAGAGAGACTCTACTCAAATTTTCTCCTTTGGTCGAAG
GAAATCATACGCGATGAGATACCCCTATCTATTACATACCCTCCCAAACC
TGCGTACAGGTTTTCTTATCTAGTCGAGTCAGGACTTGTCGACTTCTGTT
TATAGTCTAGAGTGTGGCATCT

Sequences in the Contig:

SY0AAB13YE08FM1