Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YD13FM1
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00003902001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU07367
Accession: ref|XP_958860.2| Score: 442 E_value: 4e-71
KEGG Definition: hypothetical protein ( 26s protease regulatory subunit S10b - fission yeast (Schizosaccharomyces pombe) (fragment) )
Accession: ncr:NCU07367.1 Score: 442 E_value: 2e-71
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0651 Score: 364 E_value: 9e-36
PFAM Definition: No Hit Found
Swissprot: O74445|PRS10_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>SY0AAB13YD13FM1
TTGGGCGTCAGTGTCTGCTCCAGCCATCTACCATACATCAAACTTCACGT
CCGATTTAACAATTAAATATCCTCTACTTTCCCGAGACCTTGTTAATCGA
AAATCGGTCCCCACTTCACTTTACCCACCATGTCTGATCCTGAAAGAGAG
AAGGCGCTTTCGGAATTCAAGACAAAGCTTCTTGAGCACCGAGAATGGGA
TGCAAAATTAAAAAATTTGAGGAAAGAGATTAAGGATCTTCAGAAGGAGT
TCGACCATACCGAGGAGAATATTAAGGCATTACAGAGTGTTGGTCAGATC
ATTGGGGAGGTTCTGAAACAGCTGGATGATGAACGATTTATTGTCAAAGG
TGAAGCTCAACAATAGTACCATCTTTTACTAAGTTTATCACAGGGTGTTA
ACGATTCGATAAACGATAGCTTCGTCTGGACCTCGTTATGTTGTCGGTTG
CCGCTCCAAGGTTGACAAAACAAAACTTAAGCAAGGTGTTCGTGTAGCGC
TCGACATGACTACCCTGACAATTATGAGAATGTTACCTCGAGAAGTCGAT
CCTTTGGTCTATAATATGTCACTTGAGGATCCTGGTCAGGTATCTTTTGG
TGGTATCGGAGGTCTCAATGAGCAAATTCGTGAGCTAAGAGAGGTTATCG
AACTACCACTGAAGAATCCAGAACTTTTCTTGAGAGTTG

Sequences in the Contig:

SY0AAB13YD13FM1