Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YB17FM1
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00002340001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15649
Accession: ref|XP_001805793.1| Score: 406 E_value: 3e-51
KEGG Definition: hypothetical protein
Accession: ncr:NCU06834.1 Score: 325 E_value: 1e-42
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3607 Score: 127 E_value: 3e-08
PFAM Definition: Disintegrin, Disintegrin..
Pfam Number: pfam00200 Score: 156 E_value: 1e-11
Swissprot: O13766|MDE10_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0005619 = Cellular component: fungal-type spore wall
GO:0030476 = Biological process: ascospore wall assembly

Sequence:
>SY0AAB13YB17FM1
TTGGGCGAACGAGGACTGCTGCACGGGTTGCAAGTTTGCGTCAAAAGACA
AGGTCTGCCGATCTAGCAACGGCCCCTGTGATCCCGAGGAGAGATGCACG
GGAAGGAACGCCACCTGCCCGTCAGACGTCATTTCGGGAAATGGTATGTC
ACGAGACTCTCGCCTGATGAAGCGAATCCATCCCATCTAATCACATTTAC
TACTATAGGCGATTCCTGTGGCGATGGACTGCAGTGCGCGAGTGGGCAAT
GCACATCTCGAGACCTGCAATGCAAGACGGTTATGGGGCAGTACCGGAGC
AACAGTACACATTCATGCACGGATACAGATTGCCAGCTGACTTGCGCATC
CCCGGAGTTTGGCCCGGGAACCTGCTTCCGGATGCAGCAGAATTTCCTCG
ATGGGACTCCATGTAACGGTGATGGGAGGTGTAAGGCTGGAGTATGCAGT
GGCTCGTCAACACTTGGCCAAGTTAAGAGTTGGATCAATAAGAACAAAAA
CATCGTAATAGGCGTATCAGTCGGTATAGGCGCCCTGGTAATCTTTTCCA
TCTTCTCCTGCATATGGAGTTGCTGTCGAAGAAGGCGAGCACGCAAGGCC
GCGTTGAAGAGCCCGCCGCGTCCACCCACAGGTGGGTACCAACCGCACGA
CCGGGCATGGCACA

Sequences in the Contig:

SY0AAB13YB17FM1