Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB13YA04FM1
Length(NT) : 637
Best Gene Model Blast : Link to GSTUMT00010530001 E-value : 1e-118
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15251
Accession: ref|XP_001805408.1| Score: 144 E_value: 1e-07
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB13YA04FM1
TTGGCTTGCGCTCGCTGGAACCGGTGTCGCATTCTCGCTCAGCGATGATG
TGTCGATTGAGGCTACCAACTACATTCTTTGGGCTGCTATGGCCATCGTT
TCCCTCGGTGGTGCAGCTGTGGCATACTTTGTGCGCGATCATCCTACTGT
GCGGGACTACTCTTCTTCTCTCAAGTGGGAGGTTTGCTACGAATCATCAG
AAGACCTAGCAATCTAAGCGCTGTCTCGTGATAATACCCGGTGCACAGGC
ACTCATTCTCTTGCTTTGCCGTTGCCTTTTTCTTTTTACTTACGTATCGC
TTTCCTTTTGTGGTGCAACGAGAGATATAGGAAGTCCTACCCTGACTCAG
TCACCCATTCTTCCTTCGGGGGCGGTCCCAGCTTTTGATACCGTTTTTAA
CAGCACTTGAGGTGTCGAAGTCGTTTTATCAACAAAATTGCTCGACCTTT
TTTTCTTCACGTCTGTCTCTATCTAAATATCTCTACTCTTTCCATTTGGG
AGGACCGTTGTACTGCAATCGGGATGGTGGTGGTGGTTTATTGTCTCATA
CACTTTATTTCGACATTTAGCGCTCTCTTTTATATTAGGATCTGGGAGTG
GGGGGGGTTTGTTGTATTTAAATAACTTGGGTGTCTC

Sequences in the Contig:

SY0AAB13YA04FM1