Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YP06FM1
Length(NT) : 543
Best Gene Model Blast : Link to GSTUMT00005322001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04725
Accession: ref|XP_001795137.1| Score: 384 E_value: 1e-35
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04559 Score: 375 E_value: 6e-35
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3745 Score: 185 E_value: 4e-15
PFAM Definition: Sec10, Exocyst complex component Sec10. This family contains the Sec10 component (approximately 650 residues long) of the eukaryotic exocyst complex, which specifically affects the synthesis and delivery of secretory and basolateral plasma membrane proteins..
Pfam Number: pfam07393 Score: 154 E_value: 1e-11
Swissprot: Q06245|SEC10_YEAST
Gene Ontology:
GO:0000145 = Cellular component: exocyst
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0006904 = Biological process: vesicle docking during exocytosis
GO:0006906 = Biological process: vesicle fusion

Sequence:
>SY0AAB12YP06FM1
TTGGTCAACATCGTAAACAATGACCAAATCTACTGTTGCTGAGTCTTCAC
GCACCTCCCGCTCAATATACCCTAAACCAAGCTCATTCTCCTTATCTCAC
TTCTCCACCGCTGATTTCATCGTGAAGGACTTCATAGAAGGCCTTACCGG
CTCCGCAATTCCCGCGAATCGTCGGTCGGGAACAAATTTTGGCACACCAA
CCTTCGATCCCAAACCCTACATCCGCACATTTGAAGGCGCTCTGGAGCGG
CTGAAAGACCTTGATGAGGACCTCTCAGCAAAAGAGTCTGAGCTTAAAGA
AGGCGTACGAAGGGCAGAGATGGACCATGCCCGCACAATTGATCGCTTAA
GTCTCCAATTTAACACCACCTTGTCGGAGTTTCAACGCCTCGATAGCAGC
ATCACCGATGGCGGGGGCATGGCCTCTAGGATAGGTGGGCAACTGGAGCA
GCTGGAGAAGCAGCATCAGCGGGCTGAAGATGCAAAGTTCTTAATACAGT
GCTACACAGAGTTTAGCCGTGGAGATACTTCCCGATTAGAAAA

Sequences in the Contig:

SY0AAB12YP06FM1