Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YI24FM1
Length(NT) : 551
Best Gene Model Blast : Link to GSTUMT00011465001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_502982.1| Score: 267 E_value: 4e-22
KEGG Definition: hypothetical protein
Accession: yli:YALI0D18359g Score: 267 E_value: 2e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2563 Score: 159 E_value: 5e-12
PFAM Definition: No Hit Found
Swissprot: Q503P5|MFSD7_DANRE

Sequence:
>SY0AAB12YI24FM1
TTGGGGCCGGTTGAGTTGACACCGAGTCCCCGGTGGAGGAAGTTGCCCGG
GCATTACTCCTACTTCTTAACTTGCTCCATACATCAGAATACGCTCTCAC
GATTTAGGCGCAGCGCACGCGACACATAATGGAGTTGAAGTCGCTATCCC
CACAAAATACCCACCATGGCAGTAGCAGAAACGGCGGAGCTGTGCCCGTA
TCAGAGGAAGAAGGAGGAGGAACAGGAGTTGGGGGAGAAGAGCAGCAGAG
GATAATCCCCAATGGTGGAGCGGTGGAATATAGGGTTTACAAAGAGCGGT
GGTTCGGGCTTGCTGGGTTAATGTTGATGAACATTGTGATTTCTTGGGGG
TGGCTCACGTATGCACCTGTTAGTGATAAAACGCAGATATGGTTCGGACT
TGACTCCCAGACTCCTGTGAACTGGCTGTCTACTGTTATATTCTTCACTT
ATGTGGTCGCGGCACCAGCAGTCCTATACACCCTCAACCGCCACGGTGTG
AAACCTGCACTAATGGCCTCCTCATTCCTGGTCCTAGCGGGAAACTGGAT
T

Sequences in the Contig:

SY0AAB12YI24FM1