Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YH11FM1
Length(NT) : 495
Best Gene Model Blast : Link to GSTUMT00011015001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_15135
Accession: ref|XP_001546425.1| Score: 240 E_value: 3e-21
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02847 Score: 226 E_value: 1e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB12YH11FM1
TTGGCATACCACTATCCATTAAAACACCCTTCAAGAACTCCAATATGTCG
AACAAGAATCTTAAGGACCAGCGCCGCGCCGACCTGATCATTCCATACGT
CGCCCCGACAGCCAAAGCCAACGACCGATATTGCCGCCACCATGACAAGC
ACACTTCCCATGGCAGCCATGTTCACCCGTAACAAGGTTGTCGGATGGAC
TGCCATGATCTTCGCGATACAAGCCTGGCTCAGCGAGACACCTGCCCAGC
TTGCGGGCGGTAAACAACCAGGGTACTTTGGAGTGGGAATGAGTCTTATG
GCACTCGGATTTGCGTACCTCCCACTCTTCATTCCAAGCATGGGTACCGG
ACCTTTAGGAATGGGCAGCACAACGGCCCCGGCTGAGGCCACACCTGCGT
GAGAGTGCGCACTCAATCACACTACACTTGAAATGTTGTCACAGCGAGAT
TTTTAAAGATTCAAAGCACATGTAATAATATTATCATAAAACTAT

Sequences in the Contig:

SY0AAB12YH11FM1