Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YG17FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00008305001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4701 Score: 120 E_value: 1e-07
PFAM Definition: Trypan_PARP, Procyclic acidic repetitive protein (PARP). This family consists of several Trypanosoma brucei procyclic acidic repetitive protein (PARP) like sequences. The procyclic acidic repetitive protein (parp) genes of Trypanosoma brucei encode a small family of abundant surface proteins whose expression is restricted to the procyclic form of the parasite. They are found at two unlinked loci, parpA and parpB; transcription of both loci is developmentally regulated..
Pfam Number: pfam05887 Score: 124 E_value: 6e-08

Sequence:
>SY0AAB12YG17FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAACTTTTTTGTACAAAGTT
GTCCCCAAACAACAAAAAAAAACGAAAAGTCAAAATGCAGCCCCAAACAC
TCCTTCTCCTCCTCGCCTCGGCCGTCATCCCCGCAATGGCCGCCGCCCCC
GACTGCGGCGGCGGACGCGCTCCTCCGAAGACCACAGTTCCGGGCTGCCC
TGGATACGTTGGCACTCTAAGCGCCACTTCCGAGTCCACCGCCGTTTCCG
CGCCTACAACTTCGGCTACCGGCTCGACTGTCAGTGGTAGCTCTTACGCC
TCCGTGACTCCTTCCCCAACGGGAACCGCTTATTCGAGCAAGTCCTCGGC
TTCGTCGTCCACTATCAAGATCTCTTCCCACCACGGCTCTGCCAATGCTA
CCAGTACTACTATTCGGGGCAGTGGGACGCGTGGGAATGGGACTGCGACG
GTCACGGGTCTTTCCAGCAGCAACAGCACTGGCTCTGGTTCCGTTTCCGG
TTCTGGGTCTGGCAGTGGGTCCGGTAGTGGGAGTGGATCTGGAACTGGTT
CTGGCTCTGAGAGCGGAAGTGGAAGTGGATCAGGAAGCTCCAGCTCCTCC
GCCTCC

Sequences in the Contig:

SY0AAB12YG17FM1