Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YG10FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00007781001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: PREDICTED: similar to ankyrin 2,3/unc44
Accession: ref|XP_001184164.1| Score: 398 E_value: 3e-37
KEGG Definition: LOC761852; similar to ankyrin 2,3/unc44
Accession: spu:761852 Score: 398 E_value: 2e-37
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 325 E_value: 3e-31
PFAM Definition: No Hit Found
Swissprot: Q12955|ANK3_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0006605 = Biological process: protein targeting

Sequence:
>SY0AAB12YG10FM1
TTGGAGATAATGATAACAAAACACCTTTATATTTATCTTCCTATAAGGGG
CATTCTATCGTGGTTCAGATGCTCCTGCAAGCCGGAGCTGATATTGAGGC
AAGCGACTCTTCAGGAGACAGGCCACTGCACGCTGCTTCTACAGAAGGAC
ACCAAGACGTAGTCCAACAGCTCCTGGAGGCTGGAGCGAACATGGAATCA
GTCAACATTAGCAAAGAAACCCCTTTACACCTAGCGATTAGGTATGGACA
TGATCAGGTTGCGTGGCTATTGTTACAGGCAGGAGCGGAGGTTGGTGCGA
AACGATTTGATGGGTGGACCTCTTTACATTTGAGTGCCTCGAACAATCAA
CTCGACAATGTTAGACTTCTCCTAAAATTTGGTGCAGATGTGAAGGACCA
GAATAAGCGGGGTTCCACACCCTTAGTATTGGCATCTGAAGGAGGACATA
AGGAAATCGTAAAACTTCTACTCGATCATGGATCTGATGCGGGACACGCC
ATCGGCAACAAATCTACATCACTACACCGCGCAGCACAAAACGGACACAT
GGATGTTGTGAAACTTCTGCTGGAAGCTGGTGCTAGCCCAATTTCGAAAA
AGGCTTCTAGTGATATCACCCCAA

Sequences in the Contig:

SY0AAB12YG10FM1