Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YG08FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00001035001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06110
Accession: ref|XP_001796494.1| Score: 485 E_value: 6e-59
KEGG Definition: hypothetical protein
Accession: ani:AN3424.2 Score: 449 E_value: 3e-54
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1737 Score: 364 E_value: 9e-36
PFAM Definition: Oxysterol_BP, Oxysterol-binding protein..
Pfam Number: pfam01237 Score: 164 E_value: 1e-12
Swissprot: O13944|YEH1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB12YG08FM1
TTGGCCGCAACATCATCGCTGGGGAAAAGTACGTAGAGCCTGTAGGATCC
ATGACAATCCATCACGAAAACACGGGCGAGAAAGCTATAGTAACCTTCAA
AGCCAACAAAGGCATGTTCGCTGGGCAGCGAGGAAGTAACAATCCAAGCA
TTCGATTCCTCCGGCAACCCCTACCCAGTGAGCCTTTCTGGAAAATGGAC
AGAGAAACTCATGCTCGAGGGCGTCGGCTCCCCGAAGAAATTCTGGGAAG
TGAAAGAGCTGGTAGAAAACGCACAGACAAGATACGGCTTCACCAAGTTC
GCGGCGGCGCTCAACGAGATCACACCCATCGAGCAAGGCAAGATCCCCAC
CACAGACACCAGACACCGGCCCGACCAGCGCATGGTGGAAGAGGGCCGCC
TGGACGAGGCGGAGGCCATGAAGATGAGGCTCGAAGAGGCCCAGCGAGTA
CGACGCAAGGAGATGGAAGATAACGGAGAAGCCTGGCAACCCAAATGGTT
CGTCAAGGTGCGGGAATACGCCGACGAGGAGATTTGGAAGATCAAGACGG
GCAAGGAAGGGTACTGGGAGCGGAGAAGCAAAGGCGAGTGGAAGGGTGTG
CCTGTCATCTTTGAGGAGT

Sequences in the Contig:

SY0AAB12YG08FM1