Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YE10FM1
Length(NT) : 662
Best Gene Model Blast : Link to GSTUMT00001639001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: F-box domain protein
Accession: ref|XP_001262837.1| Score: 210 E_value: 3e-15
KEGG Definition: hypothetical protein
Accession: ani:AN9113.2 Score: 192 E_value: 2e-13
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 132 E_value: 7e-09
PFAM Definition: No Hit Found
Swissprot: O74991|POF3_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAB12YE10FM1
TTGGGCCGAAAGCCACCAATCCACCGGCCGTGCAGCCTACTCCTCGGGCA
ATTACGAAGCAGCCCTAAGACACTTTACCACAGCGCTTGCACAACCAAAC
CTGCCTGCGACCCTGCGCGCGAGCATACTGGACAACCTCTCAGCCACGAA
AGAAAAACTCGGCGGTGAAGCAAACCTAACGGATGCACTGAGCAATGCCC
GCGCGATGATGCGATTACAACCGGCAGGTGTGGAGGGGTACTTACGCGGC
GGGAAGGTATTGCAGTTGCTAGGAAGGGACGGTGACGCAATTAGGTTATA
CGAATACGGCATTAACAAGCTCCCCAGCGGCGGCGGGGTCGGGCGGGAGC
GGTTAGAAGCGCAAGTTAGAAGGGTGCGCTCGAGGATTACTCGGCGGGAG
GCGATGACTAGCGAGCGTAAGCACCGTGATCCGTTCACTGCGTTACCCTC
TGAGGTGGCGCAAATAGTGCTTTTGCATCTCCCTTTCCACACTCTAATGC
TTGCGCGCGGGGTCTCGCGCGGCTGGAGGGTCTTCATTGAATCTGTGCCG
GCTACTTTCGCTACGATGGACTTGCGCGAGGCGCGGAGGTCTGTTGGCAG
TGGTACGTTCAAAGCGCTTGTTCGTGCCTCGCGGGGTGGTGTGCGTGTGG
CGAGGCTGGCGC

Sequences in the Contig:

SY0AAB12YE10FM1