Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YE01FM1
Length(NT) : 469
Best Gene Model Blast : Link to GSTUMT00000100001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 167 E_value: 1e-10
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 167 E_value: 5e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 109 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB12YE01FM1
TTGGGCTCACTCGACAATGGCAGAGATCTGCTTAAGTTACCTGAACTTTC
AGCAGGTCAAGGCTCTTTCGACTAATCCCTCTCCCAACCTCCGAGGTACA
CCTTTTCTGGAATATTCATCTCTGTACTGGGGAACTCACGCAAAACGAGA
GCTTTCGGATTGCGCGAAATTGCTTGCGCTGAAGCTATTTGGCGACTACG
GTAACCACATATCTACTAAAATCCTCTTGAAAGCACAGAAACCGTATTCG
GACGTTTATAACTTCGGCATATCTTCTCAATTCACAGGTCTCCACTGCGC
GTCCGTCTTTGGGATTGCTGAACTTGTGGCCGGTTTGATAGGTGTGGAAG
GTTATGATATCAACCAAAAAGATTGTGTGGGCAATACACCTCTCATGTGG
GCTGCGCGCAATGGTCACGCGGGAGTGGTTAAAACACTACTCGGGATGGG
CAGTGTCAGCCCCAACGGA

Sequences in the Contig:

SY0AAB12YE01FM1