Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YC02FM1
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00011389001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01106.1
Accession: ref|XP_381282.1| Score: 246 E_value: 1e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG01106.1 Score: 246 E_value: 7e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB12YC02FM1
GATCGCGCTACATTGGAGAGCGATTATAGCCGGTTGGGTGACGTTGAATG
GGGTTACGGAAGAGGGCGAGGAAGAAGCCCCATGCGTCGTTTACCACCTC
GCCGTTCACGATCTCCCCCTGTAGGTGGGAATATCGATCGTTATGTGCCT
CGATCTCCTCAACCCCGTCGCTCTCGCTCACCTTCTCGTTCGCGCTTTGA
GTACGCTCAGCATGGCGTCCCCCAGCTTCCCATGGTTGGGAAACCTGGCG
CAATTGATCGCTACGTTCCACCACACAACGGGACTGCCCCTCCCATGTAC
TTCGATCCTCATAGGCTAGACTACCAAGTCACGTTTAATTACTTCTCTGA
TTGGTACCATCAGGAAAATCCAGGTGGGACTGGCCCTAATATGAAGGAGG
AGGTAAAGCAGAAGTATGATGAATATAAGGACGAACTTACTGCGCGCCTC
GCGAAGCTGTTTGTGACCACACATAAGAATGATGAATGGTTTAAAGAACG
CTACGTCCCCGGTGAGAAGGAAGTCACAAAGGCGAAGATAGTGGACTATA
GAAGAGGGGCCTTCGAGAGATGGAGGGCTCAAATGCAGAGTGGGGCTTTA
GATAACATTGACCGTGAAACTGG

Sequences in the Contig:

SY0AAB12YC02FM1