Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB12YB06FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00002409001 E-value : 1e-108
Numbers of ESTs : 1

Blast Results:

Nr Definition: chitin synthase III
Accession: emb|CAC39621.1| Score: 439 E_value: 8e-65
KEGG Definition: chitin synthase ChsG [EC:2.4.1.16]; K00698 chitin synthase
Accession: afm:AFUA_3G14420 Score: 435 E_value: 3e-61
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG2571 Score: 236 E_value: 7e-21
PFAM Definition: No Hit Found
Swissprot: P54267|CHSG_ASPFU
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>SY0AAB12YB06FM1
TTGGGATCGTATTTTGTGTTTCGAGTTGGTTGCCAAAGCTGGGTCCAAAT
GGCATTTGACCTACGTCAAGACCTCGAAAGCCGAAACTGATGTGCCGGAA
GGTGCACCTGAGTTTATCTCCCAACGTCGTCGTTGGTTGAACGGTTCTTT
CGCTGCCAGTATTTACTCCTTGATGCATTTCGGGAGAATGTACTCCAGTA
GTCACAACGTCATTCGAATGACCTTCTTCCATATCCAGCTTGCTTACAAC
GTCTTCTCTGTAATCATGTCATGGTTCGGTTTGGGTGAGTGTCCCGAAGC
TCTAGTTAAAAAGCCAAAGCTAACGATTTCTAGCCAATTTTTGGCTCACC
ACTACCGTCATTATGGACCTCGTCGGTGACCCAACTAAGGCAGAACGCGA
CAATGGCAGGAAACCATGGCCCTTTGGTGAAGGAACTCGCATCTTTAACA
CTATCTTGAAATATCTTTATCTTGGCTTTCTCCTGCTCCAATTCATCTTG
GCCTTGGGTAACAGACCAAAAGGTTCACGTTACACTTATCTCGTCTCCTT
CGTTGTCTTCGGCTTGGTCCAATTCTACATCATCATTCTCTCGTTCTACC
TCGTCA

Sequences in the Contig:

SY0AAB12YB06FM1