Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YK19FM1
Length(NT) : 371
Best Gene Model Blast : Link to GSTUMT00008328001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 107 E_value: 2e-06

Sequence:
>SY0AAB11YK19FM1
CCTGGATGGGTACCGTTGGGCACCGGAGTCCTTCATGGACAAGAACGCAA
ATTACGCGGGCCTCCTACGCGCCGGCGAGACGGGTCGCCGGACGGAAGAC
GGTTTGCTGGTATCGAATTACTTTTCATATGCCTTCCCCAAAGACTGGAC
GTTTCCGGACGCTGGCTCGTTCGTGGTCAAGGGCTGGGAATCGTATTTCC
GGATCACCCATGCTCATGCGCTGACGGTGGAAGTGGCTAGGCCAGCTGTG
ATACTCGAGCAGCCGCCGGCTACGGTCTCGCGGGGGATAGTGGTGGATAT
GTGGAGGGAGGATGATGGGGTGGTGAAGTTTGGGAGGCATGTGGGCCATG
TGAGTATTGAGGCTTTGGGGG

Sequences in the Contig:

SY0AAB11YK19FM1