Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YK10FM1
Length(NT) : 675
Best Gene Model Blast : Link to GSTUMT00010863001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE58769.1| Score: 617 E_value: 2e-62
KEGG Definition: predicted haloacid-halidohydrolase and related hydrolases
Accession: aor:AO090023000196 Score: 617 E_value: 8e-63
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2914 Score: 431 E_value: 2e-43
PFAM Definition: Hydrolase, haloacid dehalogenase-like hydrolase. This family are structurally different from the alpha/ beta hydrolase family (pfam00561). This family includes L-2-haloacid dehalogenase, epoxide hydrolases and phosphatases. The structure of the family consists of two domains. One is an inserted four helix bundle, which is the least well conserved region of the alignment. The rest of the fold is composed of the core alpha/beta domain..
Pfam Number: pfam00702 Score: 188 E_value: 2e-15
Swissprot: O59760|YJM7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB11YK10FM1
TTGGGCAATACTAGAACTAGCAAACAAACAATGTCTACGACTAACCTCAG
ACCGATCCGCGCCTGTCTCTTTGACATGGACGGTCTCCTCCTAAACACGG
AAAATCTCTACACAAAGGTCACGAACATGATCCTAGCGGAAAGTGGACGT
CCGGCCATGCCTTGGAGTATAAAGGCTCAACTTCAGGGAAGACCAGGACC
AATAGCGACAAGCATATTCTTCGAATGGGCCCAATTAAAAATCTCCCGCG
AGGAATTCATCCGGCGCCGCTCGGAACTCCATACTGAATTCTTCCCCTCC
TGCGGCCCGCTTCCGGGAGCCCCGGAACTTCTAGAAGCCCTCTCCACAGC
AACTACCCCCTCAGGCTTACCCATTGAAGTGGCGCTCGCAACGTCCAGCA
CAGCTGACTCCTTCGAGCTAAAGACAGCACACCTACAAGACCTCTTCAAG
TACTTCCCCAAAGACCAAAAAATCCTCGGTGATGACCCACGAATCCTGCA
CGGTCGCGGGAAGCCAGCGCCCGACATATACCTTGTCGCGCTAGAGAGCA
TAAACGCTCGCTTACGTAGCGAAGGTAAGACAGAGGTTCTACCGGACGAG
TGCCTGGTTTTCGAGGACGCTGTTCCGGGAGTTGAGGCTGGGAGGAGAGC
CGGTATGCGCGTGGTCTGGATACCG

Sequences in the Contig:

SY0AAB11YK10FM1