Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YJ13FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00008099001 E-value : 1e-176
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 123 E_value: 7e-08
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 115 E_value: 5e-07

Sequence:
>SY0AAB11YJ13FM1
TTGGTATATCCTTTTAGTCTCCCTCTTGGAACGAAGGGACGAACGAACAA
ACTCTATCGTTCCCTCCTATCGATTTTTTTCAGCAAAATAGTTCCGTGAA
GGACACATTTTTATTGCGCATAATACGCCCACAAACATGCCATCACCGCT
GCAGGCCCTGCTCTTTCTCCTCCTCCAATCGCTCACAACCCCCGCCTCCG
CTTTCCCGAGGAGAGCCCGACTCGACGTTAGCGGGGGATCGGGGGGTTCT
GCTACCGGCCGAACCACAGTAGAAATAAAGTCCCCAGGCATAATCGCAGG
AATAGCTCTCGGGTCGATCGCACTCGTAATAATCCTCCTGGCGGCATTCA
TCTGGCGGCGAAAGGTCTGGCAGGATCGACAGGATCAGGAGGATTGGGAA
CGGGCGGGGAGGAGCATGCTGGATGGTGCGGAGCCACTGGCGGCGGTGGG
GAGGGATGGGTAGTTGGAGGAGGAGCAGGGGCTTGTGGAGAAGGGAGCGG
AGGGGAGGGGGACTTAAGGGAACGCTTTGAGTAGATGGGCAGGGGGATGG
AATGGGTTGTGTTGCCATTTTCCCTTTTGCAAT

Sequences in the Contig:

SY0AAB11YJ13FM1