Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YI21FM1
Length(NT) : 591
Best Gene Model Blast : Link to GSTUMT00006969001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Serine/threonine-protein kinase pakA gb|AAU88248.1| PakA
Accession: sp|Q2VWQ3|STE20_PENMA Score: 715 E_value: 5e-74
KEGG Definition: hypothetical protein
Accession: yli:YALI0F00572g Score: 710 E_value: 1e-73
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0578 Score: 749 E_value: 2e-80
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 438 E_value: 2e-44
Swissprot: Q2VWQ3|STE20_PENMA

Sequence:
>SY0AAB11YI21FM1
TTGGTGCTGCAGTTTGTCGTGAGACTTTGCAAGGGTTGCAGCATCTTCAC
TCGAAAGGCGTAATCCATAGAGATATTAAGTCTGATAACATCCTCCTGTC
ACTTGAGGGCCACATCAAATTGACCGACTTTGGTTTTTGCGCACAGATAA
ATGAAGCCATGATGAAACGTACTACAATGGTTGGCACACCGTACTGGATG
GCGCCTGAGGTTGTCACTAGGAAGGAGTATGGACGTAAGGTTGACATCTG
GAGTTTGGGGATTATGGCGATCGAGATGATCGAGGGTGAGCCACCATACT
TGACAGAATCGCCTTTGCGTGCGTTGTACTTGATCGCGACAAACGGTACT
CCTAGGCTCAAGGAACCAGATCAATTGTCGGTGGAGCTCAAGGACTTTTT
ACATTCTGCGTTGGAAGTCAGCCCAGATCGTAGGGCTTCTGCTGGAGAAC
TCCTTCAGCATTCGTTCCTTCAAACTGCGGATCCGTTGTCCAGTTTAGCG
CCTCTTGTTAAGGCTGCGCGTCAAGCTAGAGCGCAAGAACGACAGAGGGG
CTGAACGATGTACCGCGATTTATCCTATGAGCTCATTTTCG

Sequences in the Contig:

SY0AAB11YI21FM1