Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YI14FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00011277001 E-value : 4e-66
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_01110
Accession: ref|XP_001560278.1| Score: 242 E_value: 4e-19
KEGG Definition: hypothetical protein
Accession: ncr:NCU07492.1 Score: 181 E_value: 3e-12
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0974 Score: 154 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: Q08924|YP183_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0010526 = Biological process: negative regulation of transposition, RNA-mediated

Sequence:
>SY0AAB11YI14FM1
TTGGCTACAGGCCTCTCCCCACGAACCTTTGTTGAAAAACGTCTGCTAAC
TGTTTAAGCACGTCTCTAACCTGTCACCTGTGACTGCCCTTGCTTTCCAA
ACTGCTCAAAACTTTCCAAACTCAGTCCCCGGATCGAAACTACTTGTTGG
TGAAGGACCATTTGTTAAGATCTTAGATATCGTTACTCGAGAGTCTATCC
TTAAACGTCGAATATTTTCCCGAGAACGAATTCACGGAATCACACTCTCA
CCACGCAATCAACAAAACGTCTTGTTTTGGGGAGGAAGGAGCATATGTAT
TACTGCGATAACTTCTTTACCTAGGGAGGAATGTGTCCCCCGAGAAATTC
GCGTACCAGACTGGGTTTTCTATGCTGTATTCATTCCTTCTCCAACTTCG
GCTTCAGGCGAAGAGGCGGTTGTCATCACTGCCCACAATGTGTTACTTAG
ATACGATAATGCTTCGACAAGCTGGTACGAGCTAGCGTCTGGGGAGCGCT
GTATGCTATATTCCGCTCATCTCCATATTGCGGCCGATGCCCTCAATTCC
CAGGACCGAGTTCTAGTTGCAGCTGGCACTGTTTTTGGCCAGATCATACT
ATGGTCGGCTGCAATGGTCCCATCATCA

Sequences in the Contig:

SY0AAB11YI14FM1