Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YD12FM1
Length(NT) : 690
Best Gene Model Blast : Link to GSTUMT00000423001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001214475.1| Score: 165 E_value: 4e-10
KEGG Definition: predicted protein
Accession: aor:AO090023000669 Score: 159 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB11YD12FM1
TTGGCGCTTCTACTCGGCACTGGTGCATCTGATCATATCTCCTGGCGCTA
GTTGCGTCCATTCGCTCAGATCCACCATATTCTTACCCTTTGATCCCATG
CTTGAATACTGAGCTGGACTCCATCCAGGTTACTTGATTGATCATGGTTC
AATCAGAAACTACGAGTCCTTATTTCGCCGCAGCTAAGTCACGCTCTGTT
GAGCAAATGCAGCCACGGCCTCCTACGCCACCAAGAGAGTCCCCTCGGTC
AGCCTCAAAGACGAAACGATCGGTAGAAAAAGACTGTTCTATAGACAGTG
CTACCGAGTCTCTAGTGGAGCCATCTTCGCGAGAGATCACGCCTCCCTCT
TCCTCTGGGGATAACGCGACTGTGAAACCCAAGAAGCGTGTCGGCTGGTC
CCCATGGACAAAGTATCATAAGCCAGATTCGCTATTATCCGTGACTCCGA
TTCGATCAGCAATCGACCCGAAGTCTTTGAAGTCAATTCTTAAGCCCTAC
AGCTCTCCGATACCCCTTTTTGACGATAAAATGTCTTCCGAGCAACCCAT
TCCTGAGTCATTGCCCAAGTTGTTGGATTCCATCATTCAAGCGCTTGAAT
CGACCGAGCGCAGCAAGAAAATCGACGCTTATGTTACGTTCTCCAACGGC
ATGAAGGCATACGATAATATACTAAATTTAGCGCTCATGG

Sequences in the Contig:

SY0AAB11YD12FM1